Molecular Tools

GC Content Calculator for DNA and RNA Sequences

Measure guanine–cytosine percentage, base composition, AT/GC ratio, and estimated melting temperature for any nucleic acid sequence. Built for primer design, genome annotation coursework, and quick FASTA inspection.

Analyse a sequence

Paste DNA or RNA below. Results update live — no Calculate button, no sign-up. The Wallace and Marmur–Schildkraut formulas run automatically.

Quick presets

Sequence input

Paste DNA sequence (whitespace and numbers are ignored)

Valid bases: A, C, G, TLength: 92 bp

Classification

GC-rich

58.70% GC over 92 scored bases

Estimated Tm

76.6 °C

Mol. weight (ssDNA)

28.71 kDa

Base composition

18.5%

22.8%

39.1%

19.6%

GC ratio58.70%

AT ratio41.30%

Formatted sequence

Colourise bases

     1ATGGTGCATC TGACTCCTGA GGAGAAGTCT GCCGTTACTG CCCTGTGGGG CAAGGTGAAC
    61GTGGATGAAG TTGGTGGTGA GGCCCTGGGC AG

Complement strands

Complement (same orientation)

TACCACGTAGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCGTTCCACTTG
CACCTACTTCAACCACCACTCCGGGACCCGTC

Reverse complement (5′→3′)

CTGCCCAGGGCCTCACCACCAACTTCATCCACGTTCACCTTGCCCCACAGGGCAGTAACG
GCAGACTTCTCCTCAGGAGTCAGATGCACCAT

Figure 1. Watson–Crick base pairing of guanine–cytosine (G·C) and adenine–thymine (A·T). The G·C pair forms three hydrogen bonds between N1–N3, N2–O2, and O6–N4 of the complementary bases, while A·T pairs share only two bonds (N6–O4 and N1–N3). This extra hydrogen bond explains why GC-rich DNA requires more thermal energy to denature — each percentage point of GC content raises the melting temperature by roughly 0.41 °C in the Marmur–Schildkraut model.

What is GC content?

GC content is the proportion of guanine and cytosine residues in a nucleic acid, expressed as a percentage of total bases. Erwin Chargaff first quantified it in 1950 when his lab at Columbia showed that the molar ratio of A to T and G to C was conserved across species — the rules that later guided Watson and Crick's double helix model. The ratio of G+C to A+T, however, varies wildly between organisms, from 17% in Plasmodium falciparum to 75% in Streptomyces coelicolor.

At the chemical level, GC content controls duplex stability. A G·C pair forms three hydrogen bonds; an A·T pair forms two. Stacking interactions between adjacent G·C pairs add further free energy, so GC-rich helices resist denaturation by heat, formamide, and pH extremes. This single property cascades into PCR optimisation, microarray probe design, sequencing error profiles, and even nucleosome positioning.

A non-obvious fact: GC content in mammalian genomes is not uniformly distributed. The genome partitions into long compositional domains called isochores, identified by Giorgio Bernardi in 1985, where GC values cluster into five classes (L1, L2, H1, H2, H3). Gene density, recombination frequency, and chromatin accessibility all track this isochore structure.

The GC content formula

The calculation is arithmetic. Count G and C residues, divide by the total number of unambiguous bases, and multiply by 100:

GC% = (G + C) / (A + T + G + C) × 100

For RNA, substitute U for T. Ambiguity codes from the IUPAC standard — N, R, Y, S, W, K, M — are conventionally excluded from the denominator, though some software counts S (strong, G or C) as half a GC.

The melting temperature derived from GC content follows two equations depending on length. The Wallace rule, Tm = 2(A+T) + 4(G+C), suits oligonucleotides under 14 nt. Above that length, the Marmur–Schildkraut equation, Tm = 81.5 + 16.6·log₁₀[Na+] + 0.41(%GC) − 675/N, gives better estimates at standard salt conditions. Neither replaces nearest-neighbor thermodynamics for critical primer work.

Worked examples

Example 1: Forward primer for HBB

Sequence: 5′-ATGGTGCATCTGACTCCTGAG-3′ (21 nt)

Counts: A = 6, T = 5, G = 5, C = 5. Total unambiguous = 21.

GC = (5 + 5) / 21 × 100 = 47.6%

Marmur–Schildkraut Tm at 50 mM Na+ = 81.5 + 16.6·log₁₀(0.05) + 0.41(47.6) − 675/21 ≈ 48 °C. This sits in the design sweet spot — balanced GC, manageable Tm, no obvious secondary structure.

Example 2: GC-rich repeat element

Sequence: 5′-GCGCGGCCGCGGCCGCGCGG-3′ (20 nt)

Counts: G = 11, C = 9, A = 0, T = 0.

GC = 20 / 20 × 100 = 100%

Tm exceeds 80 °C and the sequence will form intramolecular hairpins and G-quadruplexes. PCR amplification across such regions usually requires DMSO, betaine, or specialised polymerases like KAPA HiFi GC.

Practical applications

Primer and probe design. Hybridisation-based assays — PCR, qPCR, FISH, Sanger sequencing primers, padlock probes — all assume a target Tm window. GC content provides the fastest screen before more expensive nearest-neighbor calculations. Most commercial primer design pipelines reject candidates outside 40–60% GC.

Genome annotation. Bacterial gene finders like Prodigal use local GC deviation to flag horizontally transferred islands. A 35% GC island embedded in a 65% GC genome usually indicates recent transfer from a different lineage. Eukaryotic gene predictors use GC content to switch between AT-rich and GC-rich training sets, since codon usage shifts with the local composition.

Forensic and ancient DNA. GC-rich sequences degrade more slowly than AT-rich regions because the extra hydrogen bond resists hydrolytic depurination. This bias affects which loci survive in archaeological samples and shapes the design of forensic STR panels.

Synthetic biology. Gene synthesis vendors charge premiums for sequences outside the 30–70% GC range because high-GC stretches require modified phosphoramidite chemistry and AT-rich stretches assemble poorly. Codon-optimisation algorithms balance translational efficiency against synthesis feasibility by targeting a window of roughly 45–55% GC.

Limitations and caveats

GC content compresses a sequence into a single number, which is its strength and its weakness. Two sequences with identical 50% GC content can behave very differently in solution — a clustered run of G·C pairs forms a stable hairpin, while an evenly distributed 50% sequence does not. For real binding thermodynamics, use ΔG calculations from tools like UNAFold or OligoAnalyzer.

The Tm estimates here assume infinite dilution at standard salt. Working PCR conditions sit at 50 mM K+ with primers at 0.2–0.5 µM, which depresses Tm by 5–15 °C. Treat the displayed Tm as a relative ranking, not an absolute annealing temperature.

This calculator is educational. For clinical primer design, regulatory submissions, or publication-grade thermodynamics, validate with at least one nearest-neighbor model (e.g. IDT OligoAnalyzer) and confirm empirically.

Frequently asked questions

What is GC content in DNA?

GC content is the percentage of guanine and cytosine bases in a nucleic acid sequence relative to all four bases. Because guanine pairs with cytosine through three hydrogen bonds (compared with two for adenine–thymine), GC-rich regions melt at higher temperatures and resist denaturation. Genomic GC content ranges from about 17% in the protozoan Plasmodium falciparum to over 70% in Streptomyces coelicolor. Within human chromosomes, GC values cluster into isochores that correlate with gene density, recombination rate, and replication timing.

How do you calculate GC content?

Count every G and every C in the sequence, add them together, divide by the total number of unambiguous bases (A + T + G + C), and multiply by 100. For a sequence of ATGCGCTAAC, the G+C count is 5 and the total length is 10, giving 50%. Most tools (including this one) ignore whitespace, line breaks, and FASTA headers automatically. Soft-masked lowercase bases are typically still counted unless you deliberately exclude repeats.

Why does GC content matter for PCR primer design?

Primers with GC content between 40% and 60% bind specifically without forming excessive secondary structure. GC-rich primers (above 65%) often produce strong but nonspecific bands because they tolerate mismatches; AT-rich primers (below 35%) dissociate too easily at standard annealing temperatures. The melting temperature Tm scales directly with GC content via the Wallace rule (Tm ≈ 2(A+T) + 4(G+C) for primers under 14 nt) or the Marmur–Schildkraut equation for longer oligos. Mismatched Tm values between forward and reverse primers reduce amplification efficiency, so most protocols recommend the pair stay within 5 °C of each other.

What is the difference between GC content and GC skew?

GC content treats G and C symmetrically and reports their combined percentage. GC skew measures the asymmetry between the two strands as (G − C) / (G + C) along a sliding window. The skew flips sign at the origin and terminus of bacterial replication because leading and lagging strands accumulate different mutational biases. Researchers use cumulative GC skew plots to predict oriC locations in newly sequenced bacterial genomes without experimental mapping.

How accurate is the melting temperature estimate?

The Wallace rule gives ±5 °C accuracy for short primers (8–14 nt) under standard salt conditions. The Marmur–Schildkraut equation used for sequences over 14 nt assumes 1 M Na+ and double-stranded DNA in solution, so real-world PCR Tm in 50 mM KCl runs 5–10 °C lower. For publication-quality primer design, use nearest-neighbor thermodynamics (SantaLucia 1998), which accounts for stacking energies between adjacent base pairs. This calculator provides a quick estimate suitable for teaching and screening, not for critical experimental design.

Why do different organisms have different GC content?

GC content reflects a balance between mutation pressure, GC-biased gene conversion during recombination, and selection on coding sequences. Thermophilic bacteria do not universally have high GC content (the GC-thermophily hypothesis is largely rejected), but their structural RNAs do — ribosomal RNA in Thermus thermophilus runs above 64% GC to stabilise secondary structure at growth temperatures near 70 °C. In vertebrates, GC-biased gene conversion at recombination hotspots drags chromosomal GC upward in regions with high crossover frequency. AT-rich genomes like Plasmodium falciparum (~19% GC) likely reflect mutational bias toward C→T deamination combined with weak counter-selection.

Does GC content predict gene density?

In mammalian genomes, yes — the gene-rich H3 isochores have GC content above 53% and contain roughly five times the gene density of the AT-rich L1 isochores at under 39% GC. CpG islands, which are GC-rich regions of about 200 bp to several kb, sit at the promoters of approximately 70% of human protein-coding genes. The correlation breaks down in compact genomes like Drosophila or in bacteria, where gene density is high across the entire chromosome regardless of local GC variation.

Can I use this tool for RNA sequences?

Yes. Switch the input mode to RNA and the calculator treats U (uracil) as the AT-pair base instead of T (thymine). The GC calculation is unchanged because RNA still contains the same G and C bases. The molecular weight estimate adjusts for the slightly higher mass of uracil ribonucleotides versus thymine deoxyribonucleotides. Note that secondary structure prediction for RNA requires dedicated tools (RNAfold, mfold) because GC content alone does not capture base-pairing interactions within the strand.

Educational note. This calculator is built for teaching, coursework, and quick screening. It does not replace nearest-neighbor thermodynamic models for clinical primer design or regulated diagnostic assays. Authoritative references: NCBI, Wikipedia: GC-content.