Molecular Tools

Oligo Analyzer for PCR Primer & Probe Design

Evaluate oligonucleotides against the SantaLucia nearest-neighbor model. Get melting temperature, hairpin secondary structure, self-dimer alignments, ΔG, molecular weight, and extinction coefficient in a single live report.

Analyse an oligonucleotide

Paste a DNA sequence to score it against the standard PCR design window: 18–24 nt, 40–60% GC, Tm 55–65 °C, no stable hairpins, no self-dimers at the 3′ end.

Quick presets

Oligonucleotide sequence

DNA sequence (5′ → 3′)

Length: 20 ntGC: 55.0%

Conditions

Oligo conc. (nM)

[Na+] / [K+] (mM)

Design quality

Redesign recommended

⚠ Self-dimer: 6 contiguous pair matches detected.

Length

20nt

GC content

55.0%

optimal

Mol. weight

5.99kDa

5991 g/mol

ε₂₆₀

183.5×10³ M⁻¹cm⁻¹

5.5 nmol/OD₂₆₀

Melting temperature comparison

Wallace rule

62.0 °C

2(A+T) + 4(G+C). Best for primers under 14 nt.

Marmur–Schildkraut

48.7 °C

81.5 + 16.6·log₁₀[Na⁺] + 0.41·%GC − 675/N.

Nearest-neighbor

50.4 °C

SantaLucia 1998 with salt correction. Best estimate.

ΔH (enthalpy)

-154.6 kcal/mol

ΔS (entropy)

-414.9 cal/(K·mol)

ΔG₃₇ (free energy)

-25.92 kcal/mol

Design parameter ranges

Length20.0 nt

10Target: 18–2440

GC content55.0 %

20Target: 40–6080

Tm (nearest-neighbor)50.4 °C

40Target: 55–6580

Hairpin prediction

✓ No significant hairpin (stem ≥3, loop ≥3) detected.

Self-dimer prediction

Best alignment: 6 base-pair matches with reverse complement.

5′ → 3′

ACCACAGTCCATGCCATCAC

||| |||

GTGATGGCATGGACTGTGGT

3′ ← 5′

⚠ Significant self-complementarity; risk of primer-dimer artefact.

Complementary strands

Complement (same orientation)

TGGTGTCAGGTACGGTAGTG

Reverse complement (5′→3′)

GTGATGGCATGGACTGTGGT

Diagram of a DNA primer annealing to a template strand during PCR, showing 5 prime to 3 prime orientation and polymerase extension — **Figure 1.** Antiparallel annealing of a 10-nucleotide DNA primer to its complementary template region during PCR. The primer aligns 5′ to 3′ above the template's 3′ to 5′ strand, forming Watson–Crick hydrogen bonds (dashed lines) at each position. The exposed 3′-OH group provides the substrate for DNA polymerase, which extends the primer by adding deoxyribonucleotides complementary to the template. Primer specificity, controlled by length and Tm, determines whether amplification occurs at the intended locus or at off-target genomic positions.

What an oligo analyzer measures

Every PCR primer, qPCR probe, and sequencing oligonucleotide carries a set of physical properties that determine whether it works. Length controls specificity. GC content controls thermal stability. Melting temperature determines the working annealing temperature. Hairpins and self-dimers compete with productive binding to the template. An oligo analyzer pulls these properties out of the sequence and presents them as a design report.

The thermodynamic backbone of modern analyzers comes from John SantaLucia's 1998 unified nearest-neighbor parameters, published in PNAS. SantaLucia averaged data from seven independent laboratories to produce a single internally consistent set of ΔH and ΔS values for the 10 unique Watson–Crick dimers (AA/TT, AT, TA, CA/TG, GT/AC, CT/AG, GA/TC, CG, GC, GG/CC). Those numbers underpin essentially every commercial primer-design tool sold today.

A non-obvious fact: the nearest-neighbor energy of GC is more negative than CG, even though both dimers contain one G and one C. This stacking asymmetry means two sequences with identical base composition can have Tm values differing by 4–6 °C. Composition-only formulas (Wallace, Marmur–Schildkraut) miss this entirely.

The nearest-neighbor model

The nearest-neighbor equation calculates Tm by summing dimer contributions plus terminal and initiation corrections:

Tm = ΔH° × 1000 / (ΔS° + R · ln(C_T/x)) − 273.15

where ΔH° = Σ ΔH_NN + ΔH_init, ΔS° = Σ ΔS_NN + ΔS_init, R = 1.987 cal/(K·mol), C_T = strand concentration, x = 1 (self-complementary) or 4 (non-self-complementary)

The terminal AT correction adds +2.2 kcal/mol to ΔH and +6.9 cal/(K·mol) to ΔS per terminal A·T pair, because terminal A·T pairs fray more readily than terminal G·C pairs. The salt correction (Owczarzy 2004) adjusts Tm for working sodium and magnesium concentrations using a logarithmic dependence on monovalent cation activity.

Free energy at body temperature (ΔG₃₇ = ΔH − 310.15 · ΔS / 1000) predicts duplex stability under physiological conditions. ΔG values more negative than −9 kcal/mol indicate stable annealing; values less negative than −5 kcal/mol predict unstable binding even at low temperatures.

Worked examples

Example 1: Well-designed qPCR primer

Sequence: 5′-ACCACAGTCCATGCCATCAC-3′ (20 nt, GAPDH forward)

Length 20 nt (optimal), GC = 55% (optimal), nearest-neighbor Tm at 250 nM / 50 mM Na+ ≈ 59.4 °C. The 3′ end CAC contains one C providing modest GC clamp. No stable hairpin or self-dimer at the 3′ end.

Verdict: Grade A. Pair with a reverse primer of similar Tm and amplify at 58–60 °C annealing.

Example 2: Problem oligo with hairpin

Sequence: 5′-GCGGCGGCCGCGGCCGCGGGCCG-3′ (23 nt)

GC = 91% (far above target), nearest-neighbor Tm exceeds 78 °C, and the analyzer detects multiple inverted repeats producing a 6-bp stem with a 3-nt loop. ΔG of the hairpin is below −5 kcal/mol — stable at PCR annealing temperatures.

Verdict: Grade D. Redesign with a different target region; this sequence will form intramolecular structure faster than it will anneal to template.

Hairpins and self-dimers in detail

Hairpins arise from intramolecular base pairing. The analyzer searches for inverted repeats — sequences where a region of the oligo matches the reverse complement of another region within the same strand. When the two regions can fold back with a loop of at least three nucleotides between them, a stem-loop structure can form. Stems of three or four base pairs are usually marginal; five or more, especially GC-rich, persist at PCR annealing temperatures and reduce yield.

Self-dimers are intermolecular. Two copies of the same oligonucleotide can anneal in an antiparallel orientation if they share a stretch of self-complementary sequence. The analyzer slides the oligo against its reverse complement at every possible offset and reports the alignment with the most contiguous matches. Self-dimers at the 3′ end are particularly damaging because they create a self-priming substrate that the polymerase can extend, generating short artefact products that consume primer and nucleotide pools.

The biological consequence shows up in real experiments. Primer-dimers compete kinetically with template binding, dominate amplification in low-template wells, produce ghost bands on agarose gels, and inflate the SYBR signal in qPCR no-template controls. For probe-based qPCR, dimers are less harmful because the fluorogenic probe ignores them, but they still consume primer and reduce sensitivity.

Practical applications

Standard PCR primer design. Target 18–24 nt with 40–60% GC, Tm 55–65 °C, and a single G or C in the 3′ pentamer. Forward and reverse primers should have Tm within 5 °C of each other to allow a single annealing temperature.

qPCR probe design. TaqMan probes typically run 18–30 nt with Tm 8–10 °C higher than the flanking primers, so the probe binds first during the annealing step. Avoid runs of identical nucleotides, especially G, which can quench fluorescence.

Sequencing primers. Sanger sequencing primers tolerate a wider design window (17–25 nt, Tm 50–65 °C) because the BigDye terminator chemistry runs at one annealing temperature regardless of primer choice. The 3′ end matters more than internal structure since polymerase incorporation depends on a free 3′-OH.

Allele-specific PCR. Place the polymorphic position at the 3′ end. Mismatches at the terminal nucleotide block extension by Taq polymerase, providing single-base discrimination. The analyzer's hairpin and dimer check is critical because the constrained 3′-end design often produces problematic structures.

Limitations and caveats

The nearest-neighbor parameters assume standard Watson–Crick base pairing in dilute aqueous solution. They do not capture the effects of GC-rich secondary structure in the template, magnesium concentration above 5 mM, formamide or DMSO co-solvents, or template tertiary structure. For GC-rich amplicons over 70% GC, use enzymes specifically validated for those conditions (KAPA HiFi GC, Phusion GC buffer).

The hairpin detector here uses a simple inverted-repeat search rather than a full dynamic-programming fold algorithm. For exhaustive secondary structure prediction with ΔG values, use Mfold or UNAFold. Similarly, the self-dimer detector finds the best contiguous alignment but does not score gapped alignments — short gapped pairings can still cause primer-dimer issues.

This analyzer is built for teaching and primer screening. For clinical diagnostic assay design or any application under regulatory oversight, validate with at least one nearest-neighbor tool with documented parameter provenance (such as IDT OligoAnalyzer) and confirm empirically with melt-curve analysis.

Frequently asked questions

What does an oligo analyzer calculate?

An oligo analyzer computes physical and thermodynamic properties of single-stranded DNA: length, GC percentage, melting temperature (Tm), molecular weight, extinction coefficient at 260 nm, Gibbs free energy of duplex formation, hairpin secondary structure, and self-dimer alignments. These metrics determine whether an oligonucleotide will function as a PCR primer, sequencing primer, hybridisation probe, or antisense reagent. The most informative output is usually the nearest-neighbor Tm, which accounts for stacking interactions between adjacent base pairs rather than treating each base independently. Together these numbers predict whether a primer will anneal specifically to its target at the chosen reaction temperature.

Which Tm calculation method is most accurate?

The nearest-neighbor method published by John SantaLucia in 1998 is the gold standard for oligonucleotides between 8 and 60 nucleotides. It sums experimentally measured enthalpy (ΔH) and entropy (ΔS) values for each of the 10 unique Watson–Crick nearest-neighbor dimers, then derives Tm at a specified strand concentration and salt concentration. The Wallace rule (2(A+T) + 4(G+C)) deviates by 5–10 °C for sequences over 14 nt. The Marmur–Schildkraut equation works for very long duplexes but assumes 1 M Na+, which is far from PCR conditions. For critical primer design, use the nearest-neighbor value with proper salt and Mg2+ correction.

What is a primer hairpin and why does it matter?

A hairpin forms when an oligonucleotide folds back on itself, with internal regions of inverse complementarity base-pairing to create a stem with a single-stranded loop. Stable hairpins compete with target hybridisation: a primer trapped in a hairpin cannot prime DNA synthesis. Stems of 5 base pairs or more, especially GC-rich stems, often persist at typical 55–65 °C annealing temperatures. Loops shorter than 3 nucleotides are geometrically impossible and loops longer than 8 destabilise the fold. When the predicted ΔG of the hairpin exceeds −3 kcal/mol, the primer is usually redesignable; below that, expect reduced amplification efficiency.

What is a primer-dimer and how does the analyzer detect it?

A primer-dimer is a short PCR artefact produced when two primer molecules anneal to each other rather than to the template, then extend across the duplex. Self-dimers form when an oligonucleotide pairs with another copy of itself in an antiparallel orientation. The analyzer aligns the sequence against its reverse complement at every possible offset and reports the configuration with the most consecutive base-pair matches. Six or more contiguous matches, especially involving the 3′ end, usually predict visible dimer bands on agarose gels and elevated baseline in SYBR-based qPCR. The fix is to redesign with at most three contiguous self-complementary bases.

What is the ideal length and GC content for a PCR primer?

For standard PCR, primers between 18 and 24 nucleotides with 40–60% GC content perform best. Shorter primers lose specificity because they have many genomic matches; longer primers raise Tm into ranges where mismatches still tolerate. GC content outside 40–60% biases the primer either toward weak binding (low GC) or toward forming secondary structure and tolerating mismatches (high GC). The 3′ end should ideally contain one or two G or C bases (the GC clamp) within the last five positions to anchor extension, but more than three G/C in the terminal pentamer increases nonspecific priming.

How do salt and primer concentration affect Tm?

Increasing monovalent cation concentration ([Na+] or [K+]) raises Tm by stabilising the duplex through electrostatic screening of the phosphate backbone. The Owczarzy 2004 correction adds approximately 16.6 × log10([Na+]/1 M) °C to the nearest-neighbor Tm. Magnesium also stabilises duplexes and modifies the effective Na+ via the Owczarzy correction for [Mg2+]. Primer concentration enters the nearest-neighbor equation logarithmically: doubling the primer concentration raises Tm by approximately 0.6 °C through mass action. Typical PCR conditions use 50–100 mM K+ and 200–500 nM primer, which is why nominal Tm values reported at 1 M Na+ overstate the working Tm by 10–15 °C.

What is the extinction coefficient and why do I need it?

The molar extinction coefficient (ε₂₆₀) converts absorbance at 260 nm into oligonucleotide concentration via the Beer–Lambert law: A₂₆₀ = ε · c · l. For single-stranded DNA, ε₂₆₀ depends on sequence because adjacent bases stack and reduce light absorption (hypochromicity). The nearest-neighbor method sums dimer extinction coefficients and subtracts internal monomer terms. A 20-mer typically has ε near 200,000 L·mol⁻¹·cm⁻¹, meaning 1 OD₂₆₀ ≈ 5 nmol of oligo. This number is essential for resuspending lyophilised oligonucleotides to a defined concentration without mass spectrometry.

Can I use this analyzer for modified oligonucleotides?

The current implementation handles only the four standard DNA bases and ambiguous N. Modified bases — locked nucleic acids (LNA), 2′-O-methyl RNA, phosphorothioates, 5-methylcytosine, inosine, biotin or fluorophore conjugates — change both thermodynamic parameters and extinction coefficients. LNA additions, for instance, can raise Tm by 2–8 °C per inserted residue. For modified oligo design, use commercial tools that maintain calibrated parameter sets, such as IDT OligoAnalyzer or Exiqon LNA Tm prediction. Phosphorothioate backbones do not change Tm significantly but affect protein binding.

Educational note. This analyzer is built for teaching, coursework, and primer screening. For clinical or regulated-assay primer design, validate with calibrated commercial tools and empirical melt-curve confirmation. References: SantaLucia 1998, PNAS, NCBI.